pORE303N_CEN12RRFuzzy3MYB
(Plasmid
#194441)
-
PurposeCRISPR, Cas9 driven by double 35S, nptII for plant selection, knockout: CEN12, RR, and Fuzzy3MYB
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194441 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepORE-R1
-
Vector typePlant Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA array targeting CEN1, RR, Fuzzy3MYB
-
gRNA/shRNA sequencesynthetic
-
SpeciesMedicago truncatula, Populus spp.
- Promoter MtU6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTTGGGAATGATGACTCATG
- 3′ sequencing primer GAGTGTCGTGCTCCACCATGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pORE303N_CEN12RRFuzzy3MYB was a gift from Chung-Jui Tsai (Addgene plasmid # 194441 ; http://n2t.net/addgene:194441 ; RRID:Addgene_194441) -
For your References section:
In vitro floral development in poplar: insights into seed trichome regulation and trimonoecy. Ortega MA, Zhou R, Chen MSS, Bewg WP, Simon B, Tsai CJ. New Phytol. 2022 Nov 16. doi: 10.1111/nph.18624. 10.1111/nph.18624 PubMed 36385612