pRN3P-NLS-EGFP-Btgh-3NLS
(Plasmid
#194469)
-
PurposeEncodes for bacterial O-GlcNAcase BtGH84 fused to enhanced GFP and NLSs for effective nuclear localization, in backbone for T3 In Vitro Transcription.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194469 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRN3P-H3.3-K9R-Gfp
- Backbone size w/o insert (bp) 3159
- Total vector size (bp) 4335
-
Vector typeBacterial Expression ; for In Vitro Transcription from T3 promoter after linearization
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsCopy number of plasmid is intermediate.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBtGH84
-
SpeciesB. thetaiotaomicron VPI-5482
-
Insert Size (bp)2148
-
Tags
/ Fusion Proteins
- mGFP5 (N terminal on insert)
- SV40 Nuclear Localization Signals (C terminal on insert)
- SV40 Nuclear Localization Signal (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer actttcacttatggtgttcaatgc
- 3′ sequencing primer gacgccaccactgattacatgc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Paper describing the insert: Dennis, R. J. et al. Structure and mechanism of a bacterial β-glucosaminidase having O-GlcNAcase activity. Nat. Struct. Mol. Biol. 13, 365–371 (2006).
Paper of lab donating backbone, also using pRN3P backbone: Eid, A., Rodriguez-Terrones, D., Burton, A. & Torres-Padilla, M. E. SUV4-20 activity in the preimplantation mouse embryo controls timely replication. Genes Dev. 30, 2513–2526 (2016).
Paper using plasmid from which Btgh insert was amplified: Boulard, M., Edwards, J. R. & Bestor, T. H. Protein O-GlcNAcylation Silences Methylated Promoters.
Please visit https://www.biorxiv.org/content/10.1101/2024.01.22.576677v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRN3P-NLS-EGFP-Btgh-3NLS was a gift from Mathieu Boulard (Addgene plasmid # 194469 ; http://n2t.net/addgene:194469 ; RRID:Addgene_194469) -
For your References section:
Perturbing Nuclear Glycosylation in the Mouse Preimplantation Embryo Slows Down Embryonic Growth. Formichetti S, Chitnavis U, Sadowska A, Liu N, Boskovic A, Boulard M. Dev Cell 10 Jan 2024 10.2139/ssrn.4687768