Skip to main content

CMV:AsCpf1-2A-GFP-U6-INS-sg
(Plasmid #194719)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 194719 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCDNA3.4
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AsCpf1
  • gRNA/shRNA sequence
    TTCCATCTCTCTCGGTGCAGGAG
  • Species
    Acidaminococcus sp.
  • Entrez Gene
    INS (a.k.a. IDDM, IDDM1, IDDM2, ILPR, IRDN, MODY10, PNDM4)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer unknown
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV:AsCpf1-2A-GFP-U6-INS-sg was a gift from Rudolf Jaenisch (Addgene plasmid # 194719 ; http://n2t.net/addgene:194719 ; RRID:Addgene_194719)
  • For your References section:

    Multiplex genome editing of human pluripotent stem cells using Cpf1. Haiting Ma, Rudolf Jaenisch. bioRxiv 10.1101/2022.04.13.488123