pPE4max-Blasticidin
(Plasmid
#194905)
-
PurposeExpressing prime editing PE4max proteins, to work in conjunction with an epegRNA encoding plasmid or Circular Vector as described in the cited article.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194905 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV-PEmax-P2A-hMLH1dn
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 12117
- Total vector size (bp) 12576
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBSD
-
Alt nameBlasticidin S deaminase
-
SpeciesSynthetic
-
Insert Size (bp)396
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cctgcagctggccaacctgcccgaccttta
- 3′ sequencing primer aaggcacagtcgaggctgatcagcgggttt
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.06.28.497995v4 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPE4max-Blasticidin was a gift from George Church (Addgene plasmid # 194905 ; http://n2t.net/addgene:194905 ; RRID:Addgene_194905) -
For your References section:
Efficient modification and preparation of circular DNA for expression in cell culture. Oliynyk RT, Church GM. Commun Biol. 2022 Dec 21;5(1):1393. doi: 10.1038/s42003-022-04363-z. 10.1038/s42003-022-04363-z PubMed 36543890