pAAV-hSyn-fDIO-mScarlet-Gphn_C4a
(Plasmid
#194973)
-
PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4a) under the control of human Synapsin promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194973 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-MCS
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 3892
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemScarlet-Gphn (isoform C4a)
-
SpeciesR. norvegicus (rat), Synthetic
-
Entrez GeneGphn (a.k.a. Geph)
-
Tag
/ Fusion Protein
- mScarlet (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCACGCGAGGCGCGAGATAG
- 3′ sequencing primer CCAGCTTGGTTCCCAATAGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-fDIO-mScarlet-Gphn_C4a was a gift from Günter Schwarz (Addgene plasmid # 194973 ; http://n2t.net/addgene:194973 ; RRID:Addgene_194973) -
For your References section:
Automated Image Analysis Reveals Different Localization of Synaptic Gephyrin C4 Splice Variants. Liebsch F, Eggersmann FR, Merkler Y, Kloppenburg P, Schwarz G. eNeuro. 2023 Jan 4;10(1):ENEURO.0102-22.2022. doi: 10.1523/ENEURO.0102-22.2022. Print 2023 Jan. 10.1523/ENEURO.0102-22.2022 PubMed 36543537