pCDNA3.1_WiChR_TS_mScarlet_ER
(Plasmid #195190)

• Purpose: High efficient, K+ selective channelrhodopsin for the inhibition of excitable cells
• Depositing Labs: Peter Hegemann, Johannes Vierock
• Publication: Vierock et al Sci Adv. 2022 Nov 16:eadd7729.

Backbone

• Vector backbone: pCDNA3.1
• Backbone size w/o insert (bp): 5366
• Total vector size (bp): 7096
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Wobblia lunata inhibitory Channelrhodopsin
• Alt name: WiChR
• Alt name: WlChR1
• Alt name: WlKCR1
• Species: Synthetic; Wobblia lunata
• Insert Size (bp): 933
• GenBank ID: OP710241.1 UZU83954.1
• Promoter: CMV
• Tags / Fusion Proteins:
  • Kir2.1 trafficking motif (C terminal on insert)
  • mScarlet (C terminal on insert)
  • ER-export sequence (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: AGCCTCGACTGTGCCTTCTA

Resource Information

• Supplemental Documents:
  • pcdna3-1_wichr_ts_mscarlet_er.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry