pCDNA3.1_WiChR_TS_mScarlet_ER
(Plasmid
#195190)
-
PurposeHigh efficient, K+ selective channelrhodopsin for the inhibition of excitable cells
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 195190 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCDNA3.1
- Backbone size w/o insert (bp) 5366
- Total vector size (bp) 7096
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameWobblia lunata inhibitory Channelrhodopsin
-
Alt nameWiChR
-
Alt nameWlChR1
-
Alt nameWlKCR1
-
SpeciesSynthetic; Wobblia lunata
-
Insert Size (bp)933
-
GenBank IDOP710241.1 UZU83954.1
- Promoter CMV
-
Tags
/ Fusion Proteins
- Kir2.1 trafficking motif (C terminal on insert)
- mScarlet (C terminal on insert)
- ER-export sequence (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer AGCCTCGACTGTGCCTTCTA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDNA3.1_WiChR_TS_mScarlet_ER was a gift from Peter Hegemann & Johannes Vierock (Addgene plasmid # 195190 ; http://n2t.net/addgene:195190 ; RRID:Addgene_195190) -
For your References section:
WiChR, a highly potassium selective channelrhodopsin for low-light one- and two-photon inhibition of excitable cells. Vierock J, Peter E, Grimm C, Rozenberg A, Chen IW, Tillert L, Castro Scalise AG, Casini M, Augustin S, Tanese D, Forget BC, Peyronnet R, Schneider-Warme F, Emiliani V, Beja O, Hegemann P. Sci Adv. 2022 Nov 16:eadd7729. 10.1126/sciadv.add7729 PubMed 36383037