pOPO646
(Plasmid
#195307)
-
PurposepBAD322-MycaTnsD, arapBAD promoter expressing cyanobacterial tRNA-Leu gene targeting TnsD protein of McCAST (Tn7575).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 195307 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBAD322
- Backbone size w/o insert (bp) 4955
- Total vector size (bp) 6271
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTnsD of McCAST
-
SpeciesMyxacorys californica WJT36-NPBG1
-
Insert Size (bp)1362
-
GenBank IDJAHHHO010000011 DQ119282.1
- Promoter Arabinose inducible arapBAD
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCCACATTGATTATTTGCACGGCG
- 3′ sequencing primer CTGGCAGTTCCCTACTCTCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOPO646 was a gift from Joseph Peters (Addgene plasmid # 195307 ; http://n2t.net/addgene:195307 ; RRID:Addgene_195307) -
For your References section:
Discovery and characterization of novel type I-D CRISPR-guided transposons identified among diverse Tn7-like elements in cyanobacteria. Hsieh SC, Peters JE. Nucleic Acids Res. 2023 Jan 25;51(2):765-782. doi: 10.1093/nar/gkac1216. 10.1093/nar/gkac1216 PubMed 36537206