pAAV_Flex_syn_SpikeyGi2_kv2.1
(Plasmid
#195314)
-
PurposeGenetically-encoded voltage indicator SpikeyGi2, soma and AIS targeted, double-flowed in AAV vector under the promoter hSyn
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 195314 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAAV-Syn-FLEX
-
Backbone manufactureroriginal from Stratagene
- Backbone size w/o insert (bp) 4661
- Total vector size (bp) 6189
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSpikeyGi2
-
SpeciesSynthetic
-
Insert Size (bp)1284
- Promoter human synapsin promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (destroyed during cloning)
- 3′ cloning site KpnI (destroyed during cloning)
- 5′ sequencing primer gcacgggcgcgaccatctgc
- 3′ sequencing primer aaagcagcgtatccacatag
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV_Flex_syn_SpikeyGi2_kv2.1 was a gift from Vincent Pieribone (Addgene plasmid # 195314 ; http://n2t.net/addgene:195314 ; RRID:Addgene_195314) -
For your References section:
High-speed low-light in vivo two-photon voltage imaging of large neuronal populations. Platisa J, Ye X, Ahrens AM, Liu C, Chen IA, Davison IG, Tian L, Pieribone VA, Chen JL. Nat Methods. 2023 Mar 27. doi: 10.1038/s41592-023-01820-3. 10.1038/s41592-023-01820-3 PubMed 36973547