-
PurposeExpresses Engineered BrCas12b in Bacteria
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 195339 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET
-
Backbone manufacturerScott Gradia Lab (Addgene plasmid # 29656)
- Backbone size w/o insert (bp) 6401
- Total vector size (bp) 9670
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBrCas12b
-
SpeciesBrevibacillus sp. SYP-B805
-
Insert Size (bp)3269
-
MutationR160E, F208W, N524V, D868V
-
GenBank IDWP_165214399.1
- Promoter T7
-
Tags
/ Fusion Proteins
- 6xHis, MBP, TEV cleavage site (N terminal on backbone)
- 6xHis (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTwist Bioscience (wild-type gene). Variants were modified by the UF lab.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
6xHis-MBP-BrCas12b-RFND was a gift from Piyush Jain (Addgene plasmid # 195339 ; http://n2t.net/addgene:195339 ; RRID:Addgene_195339) -
For your References section:
Engineering highly thermostable Cas12b via de novo structural analyses for one-pot detection of nucleic acids. Nguyen LT, Rananaware SR, Yang LG, Macaluso NC, Ocana-Ortiz JE, Meister KS, Pizzano BLM, Sandoval LSW, Hautamaki RC, Fang ZR, Joseph SM, Shoemaker GM, Carman DR, Chang L, Rakestraw NR, Zachary JF, Guerra S, Perez A, Jain PK. Cell Rep Med. 2023 May 16;4(5):101037. doi: 10.1016/j.xcrm.2023.101037. Epub 2023 May 8. 10.1016/j.xcrm.2023.101037 PubMed 37160120