GFP-itis pSel
(Plasmid
#195344)
-
PurposeSelection plasmid expressing non-fluorescent EGFP A111V
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 195344 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneunknown
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEGFP
-
Alt nameEnhanced green fluorescent protein
-
SpeciesSynthetic; Aequorea victoria
-
Insert Size (bp)717
-
MutationA111V
-
GenBank IDU55762
- Promoter J23119
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCTATCAGGACATAGCGTTGGCTA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.02.06.527367v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-itis pSel was a gift from Alexis Komor (Addgene plasmid # 195344 ; http://n2t.net/addgene:195344 ; RRID:Addgene_195344) -
For your References section:
Curing "GFP-itis" in Bacteria with Base Editors: Development of a Genome Editing Science Program Implemented with High School Biology Students. Vasquez CA, Evanoff M, Ranzau BL, Gu S, Deters E, Komor AC. CRISPR J. 2023 Apr 20. doi: 10.1089/crispr.2023.0002. 10.1089/crispr.2023.0002 PubMed 37083425