Skip to main content

pCAG-Myc-GRM1-IRES-CyRFP1
(Plasmid #195355)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195355 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAGGs
  • Backbone size w/o insert (bp) 6078
  • Total vector size (bp) 11005
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    GRM1-IRES-CyRFP1
  • Species
    R. norvegicus (rat), Synthetic
  • Insert Size (bp)
    4927
  • Promoter pCAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer caggtgcaggctgcctatc
  • 3′ sequencing primer gcacagtcgaggctgatcagc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-Myc-GRM1-IRES-CyRFP1 was a gift from Brenda Bloodgood (Addgene plasmid # 195355 ; http://n2t.net/addgene:195355 ; RRID:Addgene_195355)
  • For your References section:

    Electrical signals in the ER are cell type and stimulus specific with extreme spatial compartmentalization in neurons. Campbell EP, Abushawish AA, Valdez LA, Bell MK, Haryono M, Rangamani P, Bloodgood BL. Cell Rep. 2023 Jan 31;42(1):111943. doi: 10.1016/j.celrep.2022.111943. Epub 2023 Jan 5. 10.1016/j.celrep.2022.111943 PubMed 36640310