pCAG-ASAP3ER
(Plasmid
#195356)
-
PurposeASAP3ER under the control of the pCAG promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 195356 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCAGGs
- Backbone size w/o insert (bp) 6102
- Total vector size (bp) 7395
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameASAP3ER
-
Insert Size (bp)1293
- Promoter pCAG
-
Tag
/ Fusion Protein
- GFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer caggtgcaggctgcctatc
- 3′ sequencing primer gcacagtcgaggctgatcagc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-ASAP3ER was a gift from Brenda Bloodgood (Addgene plasmid # 195356 ; http://n2t.net/addgene:195356 ; RRID:Addgene_195356) -
For your References section:
Electrical signals in the ER are cell type and stimulus specific with extreme spatial compartmentalization in neurons. Campbell EP, Abushawish AA, Valdez LA, Bell MK, Haryono M, Rangamani P, Bloodgood BL. Cell Rep. 2023 Jan 31;42(1):111943. doi: 10.1016/j.celrep.2022.111943. Epub 2023 Jan 5. 10.1016/j.celrep.2022.111943 PubMed 36640310