pX459_V2.0_pSpCas9(BB)-2A-Puro_T-REX17_Ex1_KI
(Plasmid
#195504)
-
PurposeCas9-2A-Puro expression vector bearing a sgRNA targeting Exon 1 of human lncRNA T-REX17
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 195504 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSpCas9(BB)-2A-Puro (PX459) V2.0 (Plasmid #62988)
-
Backbone manufacturerFeng Zhang
- Backbone size w/o insert (bp) 9174
- Total vector size (bp) 9177
-
Modifications to backbonesgRNA targeting Exon 1 of human lncRNA T-REX17
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA
-
gRNA/shRNA sequenceGTGAGAGGAACCATCTTCAGG
-
SpeciesH. sapiens (human)
-
GenBank IDhg19, chr8:55140763-55140783
- Promoter U6
-
Tags
/ Fusion Proteins
- 3XFLAG (N terminal on insert)
- T2A (C terminal on insert)
- Puro (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGATACAAGGCTGTTAGAGAG
- 3′ sequencing primer ggaaagtccctattggcgtta (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bysgRNA was ordered from Sigma-Aldrich as synthetic ssODN oligonucleotide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note there is a A to S mutation in Puromycin but this has no impact on the Puromycin selection cassette.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX459_V2.0_pSpCas9(BB)-2A-Puro_T-REX17_Ex1_KI was a gift from Alexander Meissner (Addgene plasmid # 195504 ; http://n2t.net/addgene:195504 ; RRID:Addgene_195504) -
For your References section:
T-REX17 is a transiently expressed non-coding RNA essential for human endoderm formation. Landshammer A, Bolondi A, Kretzmer H, Much C, Buschow R, Rose A, Wu HJ, Mackowiak SD, Braendl B, Giesselmann P, Tornisiello R, Parsi KM, Huey J, Mielke T, Meierhofer D, Maehr R, Hnisz D, Michor F, Rinn JL, Meissner A. Elife. 2023 Jan 31;12:e83077. doi: 10.7554/eLife.83077. 10.7554/eLife.83077 PubMed 36719724