pCHA1.1-Rap2a-V5-Hygro
(Plasmid
#195510)
-
Purposelentiviral vector expressing RAP2A CDS with hygromycin selection
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 195510 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCHA1.1
- Backbone size w/o insert (bp) 7944
- Total vector size (bp) 8982
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHygromycin
-
SpeciesE. Coli
-
Insert Size (bp)1038
- Promoter hPGK
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ttccgcattctgcaagcctc
- 3′ sequencing primer ggctaagatctacagctgcc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCHA1.1-Rap2a-V5-Hygro was a gift from Joanna Wysocka (Addgene plasmid # 195510 ; http://n2t.net/addgene:195510 ; RRID:Addgene_195510) -
For your References section:
A genome-wide genetic screen uncovers determinants of human pigmentation. Bajpai VK, Swigut T, Mohammed J, Naqvi S, Arreola M, Tycko J, Kim TC, Pritchard JK, Bassik MC, Wysocka J. Science. 2023 Aug 11;381(6658):eade6289. doi: 10.1126/science.ade6289. Epub 2023 Aug 11. 10.1126/science.ade6289 PubMed 37561850