pBbA5k-acrAB-sfGFP
(Plasmid
#195516)
-
PurposeInducible expression vector for transcriptionally fused acrAB and sfGFP.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 195516 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBbA5k
- Backbone size w/o insert (bp) 3658
- Total vector size (bp) 8769
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)BW25113
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameacrAB
-
SpeciesE. coli
-
Insert Size (bp)5111
- Promoter lacUV5
-
Tag
/ Fusion Protein
- sfgfp (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggaattgtgagcggataacaatttc
- 3′ sequencing primer cgttttatttgatgcctggagatcc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBbA5k-acrAB-sfGFP was a gift from Mary Dunlop (Addgene plasmid # 195516 ; http://n2t.net/addgene:195516 ; RRID:Addgene_195516) -
For your References section:
Antibiotic export by efflux pumps affects growth of neighboring bacteria. Wen X, Langevin AM, Dunlop MJ. Sci Rep. 2018 Oct 11;8(1):15120. doi: 10.1038/s41598-018-33275-4. 10.1038/s41598-018-33275-4 PubMed 30310093