Skip to main content

pKL038 Lenti U6 dCas12a gRNA Puro mCherry
(Plasmid #195546)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195546 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    unknown
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin ; mCherry

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Lenti U6- empty cassette_Direct repeat_puro_mcherry
  • gRNA/shRNA sequence
    GGAGACGATTAATGCGTCTCC
  • Species
    H. sapiens (human)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKL038 Lenti U6 dCas12a gRNA Puro mCherry was a gift from Michael Bassik (Addgene plasmid # 195546 ; http://n2t.net/addgene:195546 ; RRID:Addgene_195546)
  • For your References section:

    Development of compact transcriptional effectors using high-throughput measurements in diverse contexts. Tycko J, Van MV, Aradhana, DelRosso N, Ye H, Yao D, Valbuena R, Vaughan-Jackson A, Xu X, Ludwig C, Spees K, Liu K, Gu M, Khare V, Mukund AX, Suzuki PH, Arana S, Zhang C, Du PP, Ornstein TS, Hess GT, Kamber RA, Qi LS, Khalil AS, Bintu L, Bassik MC. Nat Biotechnol. 2024 Nov 1. doi: 10.1038/s41587-024-02442-6. 10.1038/s41587-024-02442-6 PubMed 39487265