attB-P7-attP-YFP
(Plasmid
#195571)
-
PurposeA strong P7 promoter flanked by Bxb1 recombination sites attB and attP. Downstream of attP is a strong RBS and YFP coding sequence.
-
Depositing Lab
-
Depositing OrganizationCalifornia Institute of Technology
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 195571 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepSC101
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePromoter flanked by Bxb1 recombination sites attB and attP with YFP downstream
-
SpeciesSynthetic
-
Insert Size (bp)4656
- Promoter P7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGCTCCGGCAAAAAAACGGGCAAGG
- 3′ sequencing primer ATTACCGCCTTTGAGTGAGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr. Victoria Hsiao originally cloned it at Murray lab, Caltech for this preprint: https://www.biorxiv.org/content/10.1101/121152v3
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Dr. Victoria Hsiao originally cloned this plasmid at Murray lab, Caltech for this preprint: https://www.biorxiv.org/content/10.1101/121152v3
We use this plasmid for in vitro cell-free protein expression system for our paper.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
attB-P7-attP-YFP was a gift from Richard Murray (Addgene plasmid # 195571 ; http://n2t.net/addgene:195571 ; RRID:Addgene_195571) -
For your References section:
Characterization of Integrase and Excisionase Activity in a Cell-Free Protein Expression System Using a Modeling and Analysis Pipeline. Pandey A, Rodriguez ML, Poole W, Murray RM. ACS Synth Biol. 2023 Feb 17;12(2):511-523. doi: 10.1021/acssynbio.2c00534. Epub 2023 Jan 30. 10.1021/acssynbio.2c00534 PubMed 36715625