pAWPSG-Po-nCas9-BE
(Plasmid
#195740)
-
PurposeExpress APOVEC1-nCas9(D10A)-UGI using phenol inducible system in Methanotroph or E. coli
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 195740 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAWP89
-
Backbone manufacturerMary Lidstrom
- Backbone size w/o insert (bp) 3837
- Total vector size (bp) 12319
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameDi-Methyl Phenol Regulatory protein / APOBEC1-nCas9(D10A)-UGI
-
Alt nameDmpR / CBE
-
SpeciesMethylococcus capsulatus Bath, Escherichia coli
-
Insert Size (bp)8482
- Promoter Po (phoenol-inducible promoter)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tcgaaccctcccggcccgct
- 3′ sequencing primer tgctcgatgagtttttctaa (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAWPSG-Po-nCas9-BE was a gift from Seung-Goo Lee (Addgene plasmid # 195740 ; http://n2t.net/addgene:195740 ; RRID:Addgene_195740) -
For your References section:
A highly efficient and versatile genetic engineering toolkit for a methanotroph-based biorefinery. Jeong J, Kim TH, Jang N, Ko M, Kim SK, Baek JI, Emelianov G, Rha E, Kwon KK, Kim H, Lee EY, Lee DH, Lee H, Lee SG. Chem Eng J, 2023 10.1016/j.cej.2022.139911