Skip to main content
Addgene

pAWPSG-Po-nCas9-BE
(Plasmid #195740)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195740 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAWP89
  • Backbone manufacturer
    Mary Lidstrom
  • Backbone size w/o insert (bp) 3837
  • Total vector size (bp) 12319
  • Vector type
    Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Di-Methyl Phenol Regulatory protein / APOBEC1-nCas9(D10A)-UGI
  • Alt name
    DmpR / CBE
  • Species
    Methylococcus capsulatus Bath, Escherichia coli
  • Insert Size (bp)
    8482
  • Promoter Po (phoenol-inducible promoter)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tcgaaccctcccggcccgct
  • 3′ sequencing primer tgctcgatgagtttttctaa
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAWPSG-Po-nCas9-BE was a gift from Seung-Goo Lee (Addgene plasmid # 195740 ; http://n2t.net/addgene:195740 ; RRID:Addgene_195740)
  • For your References section:

    A highly efficient and versatile genetic engineering toolkit for a methanotroph-based biorefinery. Jeong J, Kim TH, Jang N, Ko M, Kim SK, Baek JI, Emelianov G, Rha E, Kwon KK, Kim H, Lee EY, Lee DH, Lee H, Lee SG. Chem Eng J, 2023 10.1016/j.cej.2022.139911