pAWPSG-Po-nCas9-BE- Ptac-sgRNA(mmoX_1)
(Plasmid
#195741)
-
PurposeBase editing for making a pre-stop codon in mmoX using phenol inducible system
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 195741 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAWP89
-
Backbone manufacturerMary Lidstrom
- Backbone size w/o insert (bp) 3837
- Total vector size (bp) 12000
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameDi-Methyl Phenol Regulatory protein / APOBEC1-nCas9(D10A)-UGI / Ptac-RiboJ-sgRNA(mmoX_1)
-
Alt nameDmpR / CBE / -
-
gRNA/shRNA sequenceATGCACAGGAAGTGCACCGT
-
SpeciesMethylococcus capsulatus Bath, Escherichia coli
- Promoter Po (phoenol-inducible promoter)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tcgaaccctcccggcccgct
- 3′ sequencing primer tgctcgatgagtttttctaa
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAWPSG-Po-nCas9-BE- Ptac-sgRNA(mmoX_1) was a gift from Seung-Goo Lee (Addgene plasmid # 195741 ; http://n2t.net/addgene:195741 ; RRID:Addgene_195741) -
For your References section:
A highly efficient and versatile genetic engineering toolkit for a methanotroph-based biorefinery. Jeong J, Kim TH, Jang N, Ko M, Kim SK, Baek JI, Emelianov G, Rha E, Kwon KK, Kim H, Lee EY, Lee DH, Lee H, Lee SG. Chem Eng J, 2023 10.1016/j.cej.2022.139911