pDB-His-MBP-SARM1
(Plasmid
#195762)
-
PurposePurification of SARM1 from E.coli
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 195762 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepDB-His-MBP
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSARM1
-
Alt nameSARM1
-
SpeciesH. sapiens (human)
-
Mutationtruncation of first 19 residues
-
Entrez GeneSARM1 (a.k.a. MyD88-5, SAMD2, SARM)
- Promoter T7
-
Tag
/ Fusion Protein
- HIS-MBP-TEV (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDB-His-MBP-SARM1 was a gift from Hao Wu (Addgene plasmid # 195762 ; http://n2t.net/addgene:195762 ; RRID:Addgene_195762)