Skip to main content

pLenti HsATP13A3 WT
(Plasmid #195849)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195849 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lentiviral transferplasmid
  • Backbone manufacturer
    Didier Trono
  • Backbone size w/o insert (bp) 11397
  • Total vector size (bp) 15078
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ATPase 13A3
  • Alt name
    PPH5
  • Alt name
    AFURS1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3681
  • Mutation
    D498N, L956P, M850I, V855M, R858H, L675V
  • Entrez Gene
    ATP13A3 (a.k.a. AFURS1, PPH5)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer GCAAATGGGCGGTAGGCGT
  • 3′ sequencing primer CAGACCTTGCATTCCTTTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti HsATP13A3 WT was a gift from Veerle Baekelandt (Addgene plasmid # 195849 ; http://n2t.net/addgene:195849 ; RRID:Addgene_195849)
  • For your References section:

    Novel Green Fluorescent Polyamines to Analyze ATP13A2 and ATP13A3 Activity in the Mammalian Polyamine Transport System. Houdou M, Jacobs N, Coene J, Azfar M, Vanhoutte R, Van den Haute C, Eggermont J, Daniels V, Verhelst SHL, Vangheluwe P. Biomolecules. 2023 Feb 9;13(2):337. doi: 10.3390/biom13020337. 10.3390/biom13020337 PubMed 36830711