pLenti HsATP13A3 D498N
(Plasmid
#195850)
-
PurposeExpresses D498N mutant Homo sapiens ATP13A3
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 195850 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelentiviral transferplasmid
-
Backbone manufacturerDidier Trono
- Backbone size w/o insert (bp) 11397
- Total vector size (bp) 15078
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameATPase 13A3 D498N
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3681
-
Entrez GeneATP13A3 (a.k.a. AFURS1, PPH5)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer GCAAATGGGCGGTAGGCGT
- 3′ sequencing primer CAGACCTTGCATTCCTTTGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti HsATP13A3 D498N was a gift from Veerle Baekelandt (Addgene plasmid # 195850 ; http://n2t.net/addgene:195850 ; RRID:Addgene_195850) -
For your References section:
Novel Green Fluorescent Polyamines to Analyze ATP13A2 and ATP13A3 Activity in the Mammalian Polyamine Transport System. Houdou M, Jacobs N, Coene J, Azfar M, Vanhoutte R, Van den Haute C, Eggermont J, Daniels V, Verhelst SHL, Vangheluwe P. Biomolecules. 2023 Feb 9;13(2):337. doi: 10.3390/biom13020337. 10.3390/biom13020337 PubMed 36830711