XA103+pRCPam
(Bacterial strain
#195857)
-
PurposeE. coli nonsense suppressor strain (tyrT) transformed with plasmid carrying chromogenic protein (CP) with amber nonsense mutation in chromophore. No color when grown with or without rhamnose.
-
Depositing Lab
-
Sequence Information
-
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Bacterial Strain | 195857 | Bacteria in agar stab | 1 | $89 |
Backbone
-
Vector backbonen/a
-
Vector typeThis is a strain carrying pRCPam
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XA103
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAmber Chromogenic Protein on pRCPam plasmid
-
SpeciesAcropora millepora
-
MutationGln62X in amber chromogenic protein
Cloning Information
- Cloning method Unknown
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Primer sequences for confirmation of suppressor mutation:
Sense PCR primer (5'-->3') - TTGAGGTAATGCTTGAGATGG
Antisense PCR primer (5'-->3') - TCCTGCCAGCGTTTATTG
Sequencing primer (5'-->3') - CACAGCGCGTCTTTGTTTAC
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
XA103+pRCPam was a gift from Gregory Phillips (Addgene plasmid # 195857) -
For your References section:
Changing colors and understanding: the use of mutant chromogenic protein and informational suppressor strains of Escherichia coli to explore the central dogma of molecular biology. DeWolf S, Van den Bogaard M, Hart RB, Hartman S, Boury N, Phillips GJ. J Microbiol Biol Educ. 2023 Oct 25;24(3):e00094-23. doi: 10.1128/jmbe.00094-23. eCollection 2023 Dec. 10.1128/jmbe.00094-23 PubMed 38107993