TRE-STOP EF1a-rtTA3
(Plasmid
#195882)
-
Purposecontrol construct of TRE-VEGFA EF1a-rtTA3
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 195882 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSpCTRE-CD4
-
Modifications to backboneRemoved Cas9 and CD4.
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVEGFA
-
SpeciesM. musculus (mouse), Synthetic
-
Insert Size (bp)1179
-
Entrez GeneVegfa (a.k.a. L-VEGF, Vegf, Vpf)
- Promoter TRE3GS
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer cagggcgcctataaaagagt
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TRE-STOP EF1a-rtTA3 was a gift from Elaine Fuchs (Addgene plasmid # 195882 ; http://n2t.net/addgene:195882 ; RRID:Addgene_195882) -
For your References section:
Ras drives malignancy through stem cell crosstalk with the microenvironment. Yuan S, Stewart KS, Yang Y, Abdusselamoglu MD, Parigi SM, Feinberg TY, Tumaneng K, Yang H, Levorse JM, Polak L, Ng D, Fuchs E. Nature. 2022 Nov 30. doi: 10.1038/s41586-022-05475-6. 10.1038/s41586-022-05475-6 PubMed 36450983