pSBtet-Pur-dCas9-KRAB-MeCP2_hU6-NORAD
(Plasmid
#196086)
-
PurposeInducible CRISPRi vector conferring puromycin resistance, expressing gRNA targeting lncRNA NORAD.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 196086 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSBtet-Pur-dCas9-KRAB-MeCP2_hU6-SapI
-
Backbone manufacturerCzarnek et al., 2021
- Backbone size w/o insert (bp) 11264
- Total vector size (bp) 11266
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA targeting lncRNA NORAD
-
SpeciesSynthetic
-
MutationCloned using SapI sites - destroyed after insertion
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SapI (destroyed during cloning)
- 3′ cloning site SapI (destroyed during cloning)
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSBtet-Pur-dCas9-KRAB-MeCP2_hU6-NORAD was a gift from Joanna Bereta (Addgene plasmid # 196086 ; http://n2t.net/addgene:196086 ; RRID:Addgene_196086) -
For your References section:
Construction of a Set of Novel Transposon Vectors for Efficient Silencing of Protein and lncRNA Genes via CRISPR Interference. Czarnek M, Kochan J, Wawro M, Myrczek R, Bereta J. Mol Biotechnol. 2023 Jan 28. doi: 10.1007/s12033-023-00675-5. 10.1007/s12033-023-00675-5 PubMed 36707469