pEarleyGate 100RMOA mPing
(Plasmid
#196137)
-
PurposeMeasures mPing transposition in plants
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 196137 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEarleyGate 100
-
Backbone manufacturerABRC
- Backbone size w/o insert (bp) 11648
- Total vector size (bp) 15979
-
Modifications to backboneReplaced the 35S promoter with the RPS5a promoter
-
Vector typePlant Expression ; Binary
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namePong TPase LA T2A ORF1SC1 ONE
-
SpeciesSynthetic; Oryza sativa
-
Insert Size (bp)2877
-
MutationTPase NES sequence mutated L418A, L420A; T2A peptide; ORF1 has Ping N-terminal and Pong C terminal with stronger NLS, N-terminal repeat removed
-
GenBank IDBK000586 AB087616
- Promoter RPS5a
Cloning Information for Gene/Insert 1
- Cloning method Gateway Cloning
- 5′ sequencing primer RPS5a_Prom_For - tgatttcgtacttgtgtatttgagctca
- 3′ sequencing primer OCS_Term_Rev - gaaagcaaatatcatgcgatcataggcgt
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemPing
-
SpeciesOryza sativa
-
Insert Size (bp)430
-
GenBank IDAB087615
- Promoter 35S
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer mPing_Flank_For - agacgttccaaccacgtcttcaaagcaag
- 3′ sequencing primer mPing_Flank_Rev - cctctccactgacagaaaatttgtgccca
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEarleyGate 100RMOA mPing was a gift from Charles Nathan Hancock (Addgene plasmid # 196137 ; http://n2t.net/addgene:196137 ; RRID:Addgene_196137) -
For your References section:
Pol V produced RNA facilitates transposable element excision site repair in Arabidopsis. Renken K, Mendoza SM, Diaz S, Slotkin RK, Hancock CN. MicroPubl Biol. 2023 May 16;2023:10.17912/micropub.biology.000793. doi: 10.17912/micropub.biology.000793. eCollection 2023. 10.17912/micropub.biology.000793 PubMed 37273575