Skip to main content

pEarleyGate 100RMOA mPing
(Plasmid #196137)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196137 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEarleyGate 100
  • Backbone manufacturer
    ABRC
  • Backbone size w/o insert (bp) 11648
  • Total vector size (bp) 15979
  • Modifications to backbone
    Replaced the 35S promoter with the RPS5a promoter
  • Vector type
    Plant Expression ; Binary

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Pong TPase LA T2A ORF1SC1 ONE
  • Species
    Synthetic; Oryza sativa
  • Insert Size (bp)
    2877
  • Mutation
    TPase NES sequence mutated L418A, L420A; T2A peptide; ORF1 has Ping N-terminal and Pong C terminal with stronger NLS, N-terminal repeat removed
  • GenBank ID
    BK000586 AB087616
  • Promoter RPS5a

Cloning Information for Gene/Insert 1

  • Cloning method Gateway Cloning
  • 5′ sequencing primer RPS5a_Prom_For - tgatttcgtacttgtgtatttgagctca
  • 3′ sequencing primer OCS_Term_Rev - gaaagcaaatatcatgcgatcataggcgt
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mPing
  • Species
    Oryza sativa
  • Insert Size (bp)
    430
  • GenBank ID
    AB087615
  • Promoter 35S

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (unknown if destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer mPing_Flank_For - agacgttccaaccacgtcttcaaagcaag
  • 3′ sequencing primer mPing_Flank_Rev - cctctccactgacagaaaatttgtgccca
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEarleyGate 100RMOA mPing was a gift from Charles Nathan Hancock (Addgene plasmid # 196137 ; http://n2t.net/addgene:196137 ; RRID:Addgene_196137)
  • For your References section:

    Pol V produced RNA facilitates transposable element excision site repair in Arabidopsis. Renken K, Mendoza SM, Diaz S, Slotkin RK, Hancock CN. MicroPubl Biol. 2023 May 16;2023:10.17912/micropub.biology.000793. doi: 10.17912/micropub.biology.000793. eCollection 2023. 10.17912/micropub.biology.000793 PubMed 37273575