-
PurposeVSV-G mutant (K47Q, R354A)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 196508 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMD2.G
- Backbone size w/o insert (bp) 1425
- Total vector size (bp) 5822
-
Modifications to backboneTwo points mutations in VSV-G: K47Q, R354A
-
Vector typeMammalian Expression
-
Selectable markersNA
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVSV-G
-
Insert Size (bp)1425
-
MutationK47Q, R354A
- Promoter CMV
-
Tag
/ Fusion Protein
- NA
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcccttttgctaatcatgttcatacct
- 3′ sequencing primer ttggacttagggaacaaaggaacct (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMD2.G-VSV-G-mut was a gift from Howard Chang (Addgene plasmid # 196508 ; http://n2t.net/addgene:196508 ; RRID:Addgene_196508) -
For your References section:
Engineered cell entry links receptor biology with single-cell genomics. Yu B, Shi Q, Belk JA, Yost KE, Parker KR, Li R, Liu BB, Huang H, Lingwood D, Greenleaf WJ, Davis MM, Satpathy AT, Chang HY. Cell. 2022 Dec 22;185(26):4904-4920.e22. doi: 10.1016/j.cell.2022.11.016. Epub 2022 Dec 13. 10.1016/j.cell.2022.11.016 PubMed 36516854