Skip to main content

pMD2.G-VSV-G-mut
(Plasmid #196508)

Ordering

This material is available to academics and nonprofits only. Orders shipped outside the U.S. may require additional regulatory approval, as well as a non-refundable export license fee of $85. Please log in to view availability.
Item Catalog # Description Quantity Price (USD)
Plasmid 196508 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMD2.G
  • Backbone size w/o insert (bp) 1425
  • Total vector size (bp) 5822
  • Modifications to backbone
    Two points mutations in VSV-G: K47Q, R354A
  • Vector type
    Mammalian Expression
  • Selectable markers
    NA

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VSV-G
  • Insert Size (bp)
    1425
  • Mutation
    K47Q, R354A
  • Promoter CMV
  • Tag / Fusion Protein
    • NA

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gcccttttgctaatcatgttcatacct
  • 3′ sequencing primer ttggacttagggaacaaaggaacct
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMD2.G-VSV-G-mut was a gift from Howard Chang (Addgene plasmid # 196508 ; http://n2t.net/addgene:196508 ; RRID:Addgene_196508)
  • For your References section:

    Engineered cell entry links receptor biology with single-cell genomics. Yu B, Shi Q, Belk JA, Yost KE, Parker KR, Li R, Liu BB, Huang H, Lingwood D, Greenleaf WJ, Davis MM, Satpathy AT, Chang HY. Cell. 2022 Dec 22;185(26):4904-4920.e22. doi: 10.1016/j.cell.2022.11.016. Epub 2022 Dec 13. 10.1016/j.cell.2022.11.016 PubMed 36516854