Skip to main content

psPax2-D64V-NC-mNeon
(Plasmid #196509)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196509 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    psPAX2-D64V-NC-MS2 (Plasmid #122944)
  • Modifications to backbone
    Replace MS2 coat protein with mNeon
  • Vector type
    Mammalian Expression
  • Selectable markers
    NA

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mNeon
  • Species
    Synthetic
  • Insert Size (bp)
    709
  • Promoter CMV
  • Tag / Fusion Protein
    • mNeon (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gcaaagaagggcacatagcca
  • 3′ sequencing primer ttggctctggtctgctctga
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    psPax2-D64V-NC-mNeon was a gift from Howard Chang (Addgene plasmid # 196509 ; http://n2t.net/addgene:196509 ; RRID:Addgene_196509)
  • For your References section:

    Engineered cell entry links receptor biology with single-cell genomics. Yu B, Shi Q, Belk JA, Yost KE, Parker KR, Li R, Liu BB, Huang H, Lingwood D, Greenleaf WJ, Davis MM, Satpathy AT, Chang HY. Cell. 2022 Dec 22;185(26):4904-4920.e22. doi: 10.1016/j.cell.2022.11.016. Epub 2022 Dec 13. 10.1016/j.cell.2022.11.016 PubMed 36516854