Skip to main content
Addgene

pASPIre4
(Plasmid #196656)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196656 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSEVA291
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    add glucose to avoid premature recombination by Bxb1
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Bxb1-sfGFP fusion controlled by rhamnose promoter; attB/attP-flanked discriminator; exchangable 5'-UTR and CDS (codons 1-16)
  • Species
    Synthetic
  • Mutation
    SpeI site in Bxb1 CDS
  • Promoter rhamnose-inducible promoter

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GGGGACCCCTGGATTCTCAC
  • 3′ sequencing primer TACTCAGGAGAGCGTTCACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pASPIre4 was a gift from Markus Jeschek (Addgene plasmid # 196656 ; http://n2t.net/addgene:196656 ; RRID:Addgene_196656)
  • For your References section:

    Ultradeep characterisation of translational sequence determinants refutes rare-codon hypothesis and unveils quadruplet base pairing of initiator tRNA and transcript. Hollerer S, Jeschek M. Nucleic Acids Res. 2023 Mar 21;51(5):2377-2396. doi: 10.1093/nar/gkad040. 10.1093/nar/gkad040 PubMed 36727459