pASPIre4
(Plasmid
#196656)
-
PurposeDerivative of pASPIre3. Contains SpeI restriction site within the CDS of bxb1 to enable diversification of the 5’-UTR and codons 2-16.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 196656 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSEVA291
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsadd glucose to avoid premature recombination by Bxb1
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBxb1-sfGFP fusion controlled by rhamnose promoter; attB/attP-flanked discriminator; exchangable 5'-UTR and CDS (codons 1-16)
-
SpeciesSynthetic
-
MutationSpeI site in Bxb1 CDS
- Promoter rhamnose-inducible promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GGGGACCCCTGGATTCTCAC
- 3′ sequencing primer TACTCAGGAGAGCGTTCACC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.05.02.490318v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pASPIre4 was a gift from Markus Jeschek (Addgene plasmid # 196656 ; http://n2t.net/addgene:196656 ; RRID:Addgene_196656) -
For your References section:
Ultradeep characterisation of translational sequence determinants refutes rare-codon hypothesis and unveils quadruplet base pairing of initiator tRNA and transcript. Hollerer S, Jeschek M. Nucleic Acids Res. 2023 Mar 21;51(5):2377-2396. doi: 10.1093/nar/gkad040. 10.1093/nar/gkad040 PubMed 36727459