Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

ptRNAfMet-A37
(Plasmid #196657)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 196657 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSEVA361
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    tRNAfMet-A37 expression cassette
  • Species
    E. coli
  • Promoter metY native promoter

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GGGGACCCCTGGATTCTCAC
  • 3′ sequencing primer TACTCAGGAGAGCGTTCACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ptRNAfMet-A37 was a gift from Markus Jeschek (Addgene plasmid # 196657 ; http://n2t.net/addgene:196657 ; RRID:Addgene_196657)
  • For your References section:

    Ultradeep characterisation of translational sequence determinants refutes rare-codon hypothesis and unveils quadruplet base pairing of initiator tRNA and transcript. Hollerer S, Jeschek M. Nucleic Acids Res. 2023 Mar 21;51(5):2377-2396. doi: 10.1093/nar/gkad040. 10.1093/nar/gkad040 PubMed 36727459