ptRNAfMet-A37G
(Plasmid
#196658)
-
PurposePlasmid for overexpression of mutated initiator tRNA (A37G)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 196658 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSEVA361
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nametRNAfMet-A37G expression cassette
-
SpeciesE. coli
-
MutationA37G in tRNAfMet
- Promoter metY native promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GGGGACCCCTGGATTCTCAC
- 3′ sequencing primer TACTCAGGAGAGCGTTCACC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.05.02.490318v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ptRNAfMet-A37G was a gift from Markus Jeschek (Addgene plasmid # 196658 ; http://n2t.net/addgene:196658 ; RRID:Addgene_196658) -
For your References section:
Ultradeep characterisation of translational sequence determinants refutes rare-codon hypothesis and unveils quadruplet base pairing of initiator tRNA and transcript. Hollerer S, Jeschek M. Nucleic Acids Res. 2023 Mar 21;51(5):2377-2396. doi: 10.1093/nar/gkad040. 10.1093/nar/gkad040 PubMed 36727459