pSECRETS-A
(Plasmid
#196986)
-
PurposeFor SECRETS protocol to screen for gRNA activity and specificity: bacterial expression Cas9 in the presence of anhydrotetracycline (aTc).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 196986 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBbA2c-RFP
- Backbone size w/o insert (bp) 2800
- Total vector size (bp) 7000
-
Modifications to backboneTetR placed under pAmp promoter
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameS. pyogenes Cas9
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)4107
- Promoter pltetO1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCGAGTTTACGGGTTGTTA
- 3′ sequencing primer AGTCACACTGGCTCACCTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byVector: pBbA2c-RFP (Plasmid #35326); insert: pwtCas9-bacteria (Plasmid #44250); additional insert synthesized from IDT.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSECRETS-A was a gift from Eric Josephs (Addgene plasmid # 196986 ; http://n2t.net/addgene:196986 ; RRID:Addgene_196986) -
For your References section:
Selection of extended CRISPR RNAs with enhanced targeting and specificity. Herring-Nicholas A, Dimig H, Roesing MR, Josephs EA. Commun Biol. 2024 Jan 12;7(1):86. doi: 10.1038/s42003-024-05776-8. 10.1038/s42003-024-05776-8 PubMed 38212640