Skip to main content

pSECRETS-B
(Plasmid #196987)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196987 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBbS2k-RFP
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 4500
  • Modifications to backbone
    TetR placed on pAmp promoter
  • Vector type
    Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Spy gRNA cassette
  • Species
    Synthetic
  • Insert Size (bp)
    500
  • Promoter pltetO1

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAGCGGATACATATTTGAATG
  • 3′ sequencing primer AAGTTGATAACGGACTAGCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Vector: pBbS2k-RFP (Plasmid #35330); insert: synthesized from IDT.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Protocol to clone pSECRETS-B derivatives containing off-target sequences and standard gRNAs (or x-gRNA libraries) using USER available in reference.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSECRETS-B was a gift from Eric Josephs (Addgene plasmid # 196987 ; http://n2t.net/addgene:196987 ; RRID:Addgene_196987)
  • For your References section:

    Selection of extended CRISPR RNAs with enhanced targeting and specificity. Herring-Nicholas A, Dimig H, Roesing MR, Josephs EA. Commun Biol. 2024 Jan 12;7(1):86. doi: 10.1038/s42003-024-05776-8. 10.1038/s42003-024-05776-8 PubMed 38212640