pSECRETS-B
(Plasmid
#196987)
-
PurposeFor SECRETS protocol to screen for gRNA activity and specificity: BsaI cassette for gRNA expression or for cloning (x-)gRNA librarys + off-target for SECRETS counter-selection.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 196987 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBbS2k-RFP
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 4500
-
Modifications to backboneTetR placed on pAmp promoter
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSpy gRNA cassette
-
SpeciesSynthetic
-
Insert Size (bp)500
- Promoter pltetO1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGCGGATACATATTTGAATG
- 3′ sequencing primer AAGTTGATAACGGACTAGCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byVector: pBbS2k-RFP (Plasmid #35330); insert: synthesized from IDT.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Protocol to clone pSECRETS-B derivatives containing off-target sequences and standard gRNAs (or x-gRNA libraries) using USER available in reference.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSECRETS-B was a gift from Eric Josephs (Addgene plasmid # 196987 ; http://n2t.net/addgene:196987 ; RRID:Addgene_196987) -
For your References section:
Selection of extended CRISPR RNAs with enhanced targeting and specificity. Herring-Nicholas A, Dimig H, Roesing MR, Josephs EA. Commun Biol. 2024 Jan 12;7(1):86. doi: 10.1038/s42003-024-05776-8. 10.1038/s42003-024-05776-8 PubMed 38212640