CB6-GFP-TAOK2
(Plasmid
#197110)
-
PurposeExpression of GFP-tagged TAOK2 / PSK1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 197110 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneN-GFP-CB6
-
Backbone manufacturerMichael Way
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 10705
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTAOK2
-
Alt namePSK1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3702
-
MutationWild Type
-
GenBank ID9344
-
Entrez GeneTAOK2 (a.k.a. MAP3K17, PSK, PSK1, PSK1-BETA, TAO1, TAO2, Tao2beta)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Hind111 (not destroyed)
- 3′ cloning site EcoR1 (not destroyed)
- 5′ sequencing primer TCACATGGTCCTGCTGGAGTT (GFP forward primer) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCloned by Jonathan Morris at KCL (subject to MTA with Addgene).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plese note: This construct originated from a T47-D breast carcinoma cell cDNA library and contains the R1211H variant in PSK1/TAOK2.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CB6-GFP-TAOK2 was a gift from Jonathan Morris (Addgene plasmid # 197110 ; http://n2t.net/addgene:197110 ; RRID:Addgene_197110) -
For your References section:
Rnd3 interacts with TAO kinases and contributes to mitotic cell rounding and spindle positioning. Garg R, Koo CY, Infante E, Giacomini C, Ridley AJ, Morris JDH. J Cell Sci. 2020 Mar 16;133(6):jcs235895. doi: 10.1242/jcs.235895. 10.1242/jcs.235895 PubMed 32041905