pLV-Ftractin-mCherry
(Plasmid #85131)

• Purpose: lentiviral expression of an F-actin live-cell marker (mCherry)
• Depositing Lab: Tobias Meyer
• Publication: Hayer et al Nat Cell Biol. 2016 Dec;18(12):1311-1323. doi: 10.1038/ncb3438. Epub 2016 Nov 14.

Backbone

• Vector backbone: CSII-EF
• Backbone size w/o insert (bp): 9234
• Total vector size (bp): 10095
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Ftractin-mCherry (amino acids 9-52 of rat ITPKA, C-temrinally tagged with mCherry)
• Species: R. norvegicus (rat)
• Insert Size (bp): 861
• Promoter: EF1a
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC
• 3′ sequencing primer: ATGTGGTATGGCTGATTATG

Resource Information

• Supplemental Documents:
  • P951_EF1a-Ftractin-mCherry-lenti.gb
• A portion of this plasmid was derived from a plasmid made by: Wollman R and Meyer T. (2012), Nat. Cell Biol. 12:1261-9. PMID: 23143397
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry