Skip to main content

pMD.RVG.CVS24-B2c
(Plasmid #19713)

Ordering

This material is available to academics and nonprofits only. Orders shipped outside the U.S. may require additional regulatory approval, as well as a non-refundable export license fee of $85. Please log in to view availability.
Item Catalog # Description Quantity Price (USD)
Plasmid 19713 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    derived from pMD.G see Addgene
  • Backbone manufacturer
    see Ref. for vector modif.
  • Backbone size w/o insert (bp) 4421
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Rabies virus CVS24-B2c glycoprotein
  • Alt name
    viral glycoprotein
  • Alt name
    CVS24 strain
  • Alt name
    rabies virus
  • Species
    Rabies virus
  • Insert Size (bp)
    1575

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Asc1 (not destroyed)
  • 3′ cloning site BsiW1 (not destroyed)
  • 5′ sequencing primer TGTGTGCTGGCCCATCACTTTG
  • 3′ sequencing primer ACTTTCTGATAGGCAGCCTGCAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The gene of the rabies virus glycoprotein of the CVS24-B2c strain was obtained from Dr. Bernhard Dietzschold at Thomas Jefferson University in Philadelphia. It was PCR amplified while linkers were attached and was inserted into the new pMD.Link plasmid derived from pMD.G.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMD.RVG.CVS24-B2c was a gift from Manfred Schubert (Addgene plasmid # 19713 ; http://n2t.net/addgene:19713 ; RRID:Addgene_19713)
  • For your References section:

    Transduction of motor neurons and muscle fibers by intramuscular injection of HIV-1-based vectors pseudotyped with select rabies virus glycoproteins. Mentis GZ, Gravell M, Hamilton R, Shneider NA, O'Donovan MJ, Schubert M. J Neurosci Methods. 2006 Oct 30. 157(2):208-17. 10.1016/j.jneumeth.2006.04.011 PubMed 16725205