Skip to main content

pNeg-Ma-barnase-TAG3-TAG45
(Plasmid #197572)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 197572 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Custom
  • Total vector size (bp) 4727
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    Barnase - 2xTAG
  • Species
    Bacillus amyloliquefaciens
  • Insert Size (bp)
    336
  • Mutation
    3TAG and 45TAG
  • Promoter araC
  • Tag / Fusion Protein
    • none

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    M. alvus Pyl-tRNA (6)
  • Species
    Methanomethylophilus alvus
  • Insert Size (bp)
    69
  • Promoter lpp

Cloning Information for Gene/Insert 2

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNeg-Ma-barnase-TAG3-TAG45 was a gift from Ryan Mehl (Addgene plasmid # 197572 ; http://n2t.net/addgene:197572 ; RRID:Addgene_197572)
  • For your References section:

    Generating Efficient Methanomethylophilus alvus Pyrrolysyl-tRNA Synthetases for Structurally Diverse Non-Canonical Amino Acids. Avila-Crump S, Hemshorn ML, Jones CM, Mbengi L, Meyer K, Griffis JA, Jana S, Petrina GE, Pagar VV, Karplus PA, Petersson EJ, Perona JJ, Mehl RA, Cooley RB. ACS Chem Biol. 2022 Dec 16;17(12):3458-3469. doi: 10.1021/acschembio.2c00639. Epub 2022 Nov 16. 10.1021/acschembio.2c00639 PubMed 36383641