pDule- Mj Acd A9
(Plasmid
#197651)
-
PurposeE. coli machinery vector for the genetic encoding of acridone at TAG codons using the M. jannaschii Acd-A9 synthetase/tRNA pair
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 197651 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDule
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 6300
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameMj Acd A9 synthetase
-
SpeciesMethanocaldococcus jannaschii
-
Insert Size (bp)921
-
MutationY32A, L65D, F108L, Q109E, D158S, L162T
- Promoter GlnS
-
Tag
/ Fusion Protein
- None
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CGTCACTGCGTCTTTTACTG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameMethanocaldococcus jannaschii tRNA
-
SpeciesMethanocaldococcus jannaschii
- Promoter lpp
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TTCTGTTGCCCGTCTCACTGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDule- Mj Acd A9 was a gift from Ryan Mehl (Addgene plasmid # 197651 ; http://n2t.net/addgene:197651 ; RRID:Addgene_197651) -
For your References section:
Improving target amino acid selectivity in a permissive aminoacyl tRNA synthetase through counter-selection. Sungwienwong I, Hostetler ZM, Blizzard RJ, Porter JJ, Driggers CM, Mbengi LZ, Villegas JA, Speight LC, Saven JG, Perona JJ, Kohli RM, Mehl RA, Petersson EJ. Org Biomol Chem. 2017 May 3;15(17):3603-3610. doi: 10.1039/c7ob00582b. 10.1039/c7ob00582b PubMed 28397914