Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #102962)


Item Catalog # Description Quantity Price (USD)
Plasmid 102962 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size (bp) 5675
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    NEB Shuffle T7 recommended for protein expression
  • Copy number
    High Copy


  • Gene/Insert name

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Kpn 1 (not destroyed)
  • 3′ cloning site Nhe 1 (not destroyed)
  • 5′ sequencing primer GGTCGTCAGACTGTCGATGAAGCC
  • 3′ sequencing primer TGTCCTACTCAGGAGAGCGTTCAC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

In the presence of IPTG and biotin, bacteria will generate MBP/biotinylated fusion protein.
MBP fusion protein with C-terminal MCS-TEV-AviTAG-HIS
Vector expresses BirA (Biotin ligase) from E.coli.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMal-T-Avi-His/BirA was a gift from Tonia Rex (Addgene plasmid # 102962 ; ; RRID:Addgene_102962)