Skip to main content
Addgene

pDule2 - Mj Acd A9
(Plasmid #197652)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 197652 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDule2
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 6900
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    Mj Acd A9 synthetase
  • Species
    Methanocaldococcus jannaschii
  • Insert Size (bp)
    921
  • Mutation
    Y32A, L65D, F108L, Q109E, D158S, L162T
  • Promoter GlnS
  • Tag / Fusion Protein
    • None

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CGTCACTGCGTCTTTTACTG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Methanocaldococcus jannaschii tRNA
  • Species
    Methanocaldococcus jannaschii
  • Promoter lpp

Cloning Information for Gene/Insert 2

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDule2 - Mj Acd A9 was a gift from Ryan Mehl (Addgene plasmid # 197652 ; http://n2t.net/addgene:197652 ; RRID:Addgene_197652)
  • For your References section:

    Improving target amino acid selectivity in a permissive aminoacyl tRNA synthetase through counter-selection. Sungwienwong I, Hostetler ZM, Blizzard RJ, Porter JJ, Driggers CM, Mbengi LZ, Villegas JA, Speight LC, Saven JG, Perona JJ, Kohli RM, Mehl RA, Petersson EJ. Org Biomol Chem. 2017 May 3;15(17):3603-3610. doi: 10.1039/c7ob00582b. 10.1039/c7ob00582b PubMed 28397914