pAAV-EF1α-Flex/3'USS-mCherry(ATG full mut)
(Plasmid
#197893)
-
PurposeCan be used to generate AAV virus that will express mCherry in the presence of Cre and the leakage expression is significantly reduced without Cre
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 197893 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-MCS
- Total vector size (bp) 6906
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsStbl3 and DH5alpha are also suitable growth strains.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry
-
SpeciesDiscosoma sp.
-
Insert Size (bp)711
-
MutationN/A
- Promoter EF1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atggagtttccccacactga
- 3′ sequencing primer cagcgtatccacatagcg
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EF1α-Flex/3'USS-mCherry(ATG full mut) was a gift from Kazuto Kobayashi (Addgene plasmid # 197893 ; http://n2t.net/addgene:197893 ; RRID:Addgene_197893) -
For your References section:
Highly selective transgene expression through the flip-excision switch system by using a unilateral spacer sequence. Matsushita N, Kato S, Nishizawa K, Sugawara M, Takeuchi K, Miyasaka Y, Mashimo T, Kobayashi K. Cell Rep Methods. 2023 Jan 18;3(2):100393. doi: 10.1016/j.crmeth.2022.100393. eCollection 2023 Feb 27. 10.1016/j.crmeth.2022.100393 PubMed 36936079