HBT_pcoCASphi_version1
(Plasmid
#197931)
-
PurposeCloning vector with Arabidopsis codon optimized Casphi-2 protein, with SV40 NLS at the N-terminal and nucleoplasmin NLS at the C-terminal
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 197931 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneHBT
- Backbone size w/o insert (bp) 3484
- Total vector size (bp) 6110
-
Vector typePlant Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepcoCasphi-2
-
Alt nameArabidopsis codon optimized Casphi-2
-
Alt nameCas12j2
-
SpeciesSynthetic
- Promoter 35SPPDK promoter
-
Tags
/ Fusion Proteins
- FLAG tag and SV40 NLS (N terminal on insert)
- nucleoplasmin NLS (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTCACGTAGTAAGCAGCTCTC
- 3′ sequencing primer CAGAAATTATATGATAATCATCGCAAGAC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HBT_pcoCASphi_version1 was a gift from Steven Jacobsen (Addgene plasmid # 197931 ; http://n2t.net/addgene:197931 ; RRID:Addgene_197931) -
For your References section:
Genome editing in plants using the compact editor CasPhi. Li Z, Zhong Z, Wu Z, Pausch P, Al-Shayeb B, Amerasekera J, Doudna JA, Jacobsen SE. Proc Natl Acad Sci U S A. 2023 Jan 24;120(4):e2216822120. doi: 10.1073/pnas.2216822120. Epub 2023 Jan 18. 10.1073/pnas.2216822120 PubMed 36652483