Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

HBT_pcoCASphi_version1
(Plasmid #197931)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 197931 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    HBT
  • Backbone size w/o insert (bp) 3484
  • Total vector size (bp) 6110
  • Vector type
    Plant Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pcoCasphi-2
  • Alt name
    Arabidopsis codon optimized Casphi-2
  • Alt name
    Cas12j2
  • Species
    Synthetic
  • Promoter 35SPPDK promoter
  • Tags / Fusion Proteins
    • FLAG tag and SV40 NLS (N terminal on insert)
    • nucleoplasmin NLS (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTCACGTAGTAAGCAGCTCTC
  • 3′ sequencing primer CAGAAATTATATGATAATCATCGCAAGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HBT_pcoCASphi_version1 was a gift from Steven Jacobsen (Addgene plasmid # 197931 ; http://n2t.net/addgene:197931 ; RRID:Addgene_197931)
  • For your References section:

    Genome editing in plants using the compact editor CasPhi. Li Z, Zhong Z, Wu Z, Pausch P, Al-Shayeb B, Amerasekera J, Doudna JA, Jacobsen SE. Proc Natl Acad Sci U S A. 2023 Jan 24;120(4):e2216822120. doi: 10.1073/pnas.2216822120. Epub 2023 Jan 18. 10.1073/pnas.2216822120 PubMed 36652483