Skip to main content

pEGFP-U6-shR-Scr
(Plasmid #19800)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 19800 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-U6
  • Backbone size w/o insert (bp) 5000
  • Vector type
    Mammalian Expression, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    scrambled shRNA
  • Insert Size (bp)
    50

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PmeI (destroyed during cloning)
  • 3′ cloning site EcoRI (destroyed during cloning)
  • 5′ sequencing primer ATATCCCTTGGAGAAAAGCCTT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The scrambled sequence for shR-Scr - 5'-GCGATGCTCTAAGGTTCTATCAA

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-U6-shR-Scr was a gift from Zuoshang Xu (Addgene plasmid # 19800 ; http://n2t.net/addgene:19800 ; RRID:Addgene_19800)
  • For your References section:

    A construct with fluorescent indicators for conditional expression of miRNA. Qiu L, Wang H, Xia X, Zhou H, Xu Z. BMC Biotechnol. 2008 Oct 7;8:77. doi: 10.1186/1472-6750-8-77. 10.1186/1472-6750-8-77 PubMed 18840295