pCAGG-GST-TEV-NAP1 (WT)
(Plasmid
#198034)
-
PurposeUsed for the expression and purification of NAP1 in a mammalian expression system (SMC Internal No. 2064)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 198034 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAGG
-
Backbone manufacturerGenScript
- Backbone size w/o insert (bp) 4790
- Total vector size (bp) 7445
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNAP1
-
Alt nameAZI2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1903
-
GenBank IDAY151386
-
Entrez GeneAZI2 (a.k.a. AZ2, NAP1, TILP)
-
Tag
/ Fusion Protein
- GST-TEV (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gatgatatctgtattctgaatcatgaaa
- 3′ sequencing primer taattcttataaaggcagttctgatta
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGG-GST-TEV-NAP1 (WT) was a gift from Sascha Martens (Addgene plasmid # 198034 ; http://n2t.net/addgene:198034 ; RRID:Addgene_198034) -
For your References section:
Unconventional initiation of PINK1/Parkin mitophagy by Optineurin. Nguyen TN, Sawa-Makarska J, Khuu G, Lam WK, Adriaenssens E, Fracchiolla D, Shoebridge S, Bernklau D, Padman BS, Skulsuppaisarn M, Lindblom RSJ, Martens S, Lazarou M. Mol Cell. 2023 May 18;83(10):1693-1709.e9. doi: 10.1016/j.molcel.2023.04.021. 10.1016/j.molcel.2023.04.021 PubMed 37207627