pRD323
(Plasmid
#198044)
-
PurposeExpression of HMfA K31A E35A in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 198044 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET30b
- Backbone size w/o insert (bp) 5204
- Total vector size (bp) 5414
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHMfA K31A E35A
-
SpeciesSynthetic
-
Insert Size (bp)210
- Promoter T7 promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer taatacgactcactatagg
- 3′ sequencing primer cgtttagaggccccaaggggttatgctag
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRD323 was a gift from Remus Dame (Addgene plasmid # 198044 ; http://n2t.net/addgene:198044 ; RRID:Addgene_198044) -
For your References section:
Specific DNA binding of archaeal histones HMfA and HMfB. Erkelens AM, Henneman B, van der Valk RA, Kirolos NCS, Dame RT. Front Microbiol. 2023 Apr 18;14:1166608. doi: 10.3389/fmicb.2023.1166608. eCollection 2023. 10.3389/fmicb.2023.1166608 PubMed 37143534