Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pL1P4 ZmUbiP:GRF-GIF:NosT
(Plasmid #198048)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 198048 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pICH47761 AddGene #48003
  • Backbone manufacturer
    Sylvestre Marillonnet
  • Backbone size w/o insert (bp) 4348
  • Total vector size (bp) 8543
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ZmUbiP::TaGRF4-GIF1::NosT
  • Alt name
    Overexpression Growth-Regulating Factor 4 and cofactor GRF-Interacting Factor 1
  • Species
    Synthetic
  • Insert Size (bp)
    4195
  • Promoter Zea mays (maize) ubiquitin promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Eco31I (BsaI) (destroyed during cloning)
  • 3′ cloning site Eco31I (BsaI) (destroyed during cloning)
  • 5′ sequencing primer GAACCCTGTGGTTGGCATGCACATAC
  • 3′ sequencing primer CTGGTGGCAGGATATATTGTGGTG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Debernardi JM, Tricoli DM, Ercoli MF, Hayta S, Ronald P, Palatnik JF, Dubcovsky J. Nat Biotechnol 38, 1274–1279 (2020). We acknowledge the researchers at UC Davis and HHMI for the development of GRF4-GIF1 fusion reported in PMID: 33046875.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pL1P4 ZmUbiP:GRF-GIF:NosT was a gift from John Innes Centre - Crop Transformation and Genome Editing Group & Cristobal Uauy (Addgene plasmid # 198048 ; http://n2t.net/addgene:198048 ; RRID:Addgene_198048)