Membrane mNeonGreen
(Plasmid
#198057)
-
PurposePlasma membrane localizing mNeonGreen using Human LCK proto-oncogene sequence
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198057 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCS2+8
- Backbone size w/o insert (bp) 4137
- Total vector size (bp) 4961
-
Vector typeSynthetic Biology ; sea urchin, mammal, zebrafish
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLCK membrane mNeonGreen
-
Alt nameLCK proto-oncogene, Src family tyrosine kinase
-
SpeciesH. sapiens (human); A.victoria
-
Insert Size (bp)828
-
MutationTandem repeat of N-terminal LCK membrane targeting sequence (MGCIKSKRKDNLNDDEAAMGCIKSKRKDNLNDDEAPVAT) fused to mNeonGreen
-
GenBank ID
-
Entrez GeneLCK (a.k.a. IMD22, LSK, YT16, p56lck, pp58lck)
- Promoter sp6
-
Tag
/ Fusion Protein
- mNeonGreen (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TGACGTAAATGGGCGGTAGG
- 3′ sequencing primer GTCATAGCTGTTTCCTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTwist Bioscience
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Membrane mNeonGreen was a gift from Amro Hamdoun (Addgene plasmid # 198057 ; http://n2t.net/addgene:198057 ; RRID:Addgene_198057)