Skip to main content
Addgene

pCI-neo-μ1A-(HA)3
(Plasmid #198177)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198177 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCI-neo
  • Backbone size w/o insert (bp) 5474
  • Total vector size (bp) 6842
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    AP-1 μ1A
  • Species
    M. musculus (mouse)
  • Promoter CMV
  • Tag / Fusion Protein
    • triple HA tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer pCI-neo forward: 5’ CTCTCCACAGGTGTCCACTCCCAGTTC
  • 3′ sequencing primer pCI-neo reverse: 5’ CACTGCATTCTAGTTGTGGTTTGTCCAAACTCATC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

μ1A + linker + HA tag subcloned between EcoRI and SalI sites, double HA tag subcloned between SalI and NotI sites

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCI-neo-μ1A-(HA)3 was a gift from Juan Bonifacino (Addgene plasmid # 198177 ; http://n2t.net/addgene:198177 ; RRID:Addgene_198177)
  • For your References section:

    The adaptor protein-1 mu1B subunit expands the repertoire of basolateral sorting signal recognition in epithelial cells. Guo X, Mattera R, Ren X, Chen Y, Retamal C, Gonzalez A, Bonifacino JS. Dev Cell. 2013 Nov 11;27(3):353-66. doi: 10.1016/j.devcel.2013.10.006. 10.1016/j.devcel.2013.10.006 PubMed 24229647