pCI-neo-μ4-(HA)3
(Plasmid
#198180)
-
PurposeExpression of HA-tagged AP-4 μ4 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198180 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCI-neo
- Backbone size w/o insert (bp) 5474
- Total vector size (bp) 6932
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAP-4 μ4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1480
- Promoter CMV
-
Tag
/ Fusion Protein
- triple HA tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer pCI-neo forward: 5’ CTCTCCACAGGTGTCCACTCCCAGTTC
- 3′ sequencing primer pCI-neo reverse: 5’ CACTGCATTCTAGTTGTGGTTTGTCCAAACTCATC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
μ4 + linker + HA tag subcloned between EcoRI and SalI sites, double HA tag subcloned between SalI and NotI sites
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCI-neo-μ4-(HA)3 was a gift from Juan Bonifacino (Addgene plasmid # 198180 ; http://n2t.net/addgene:198180 ; RRID:Addgene_198180) -
For your References section:
Co-assembly of viral envelope glycoproteins regulates their polarized sorting in neurons. Mattera R, Farias GG, Mardones GA, Bonifacino JS. PLoS Pathog. 2014 May 15;10(5):e1004107. doi: 10.1371/journal.ppat.1004107. eCollection 2014 May. 10.1371/journal.ppat.1004107 PubMed 24831812